 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| chr5:58225735-58230830 | |||
| Gene | n/a | Organism | Chicken |
| Genome Locus | chr5:58225735-58230830:n/a | Build | n/a |
| Disease | Avian leukosis viral infection | ICD-10 | Viral infection, unspecified (B34.9) |
| DBLink | Link to database | PMID | 28415618 |
| Experimental Method | |||
| Sample Type | Tissues | Comparison | 3 Avian Leukosis Virus subgroup J (ALV-J)-resistant and 3 ALV-J-susceptible chicken |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward CTTCAGGGCTTCATCTGCTCTC ReverseGACTCCATTACTCCAGACAAAGTACG | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
| Citation | |||
| Zhang, X, Yan, Y, Lei, X, Li, A, Zhang, H, Dai, Z, Li, X, Chen, W, Lin, W, Chen, F, Ma, J, Xie, Q (2017). Circular RNA alterations are involved in resistance to avian leukosis virus subgroup-J-induced tumor formation in chickens. Oncotarget, 8, 21:34961-34970. | |||